Changes in human gut flora with age, ARTYKUŁY NAUKOWE (probiotyki, mikroflora, germ-free)

[ Pobierz całość w formacie PDF ]
//-->Maratheet al. BMC Microbiology2012,12:222RESEARCH ARTICLEOpen AccessChanges in human gut flora with age: an Indianfamilial studyNachiket Marathe1, Sudarshan Shetty1, Vikram Lanjekar2, Dilip Ranade2*and Yogesh Shouche1*AbstractBackground:The gut micro flora plays vital role in health status of the host. The majority of microbes residing inthe gut have a profound influence on human physiology and nutrition. Different human ethnic groups vary ingenetic makeup as well as the environmental conditions they live in. The gut flora changes with genetic makeupand environmental factors and hence it is necessary to understand the composition of gut flora of different ethnicgroups. Indian population is different in physiology from western population (YY paradox) and thus the gut flora inIndian population is likely to differ from the extensively studied gut flora in western population. In this study wehave investigated the gut flora of two Indian families, each with three individuals belonging to successivegenerations and living under the same roof.Results:Denaturation gradient gel electrophoresis analysis showed age-dependant variation in gut microfloraamongst the individuals within a family. Different bacterial genera were dominant in the individual of varying agein clone library analysis. Obligate anaerobes isolated from individuals within a family showed age related differencesin isolation pattern, with 27% (6 out of 22) of the isolates being potential novel species based on 16S rRNA genesequence. In qPCR a consistent decrease inFirmicutesnumber and increase inBacteroidetesnumber with increasingage was observed in our subjects, this pattern of change inFirmicutes / Bacteroidetesratio with age is different thanpreviously reported in European population.Conclusion:There is change in gut flora with age amongst the individuals within a family. The isolation of highpercent of novel bacterial species and the pattern of change inFirmicutes /Bacteroidetesratio with age suggeststhat the composition of gut flora in Indian individuals may be different than the western population. Thus, furtherextensive study is needed to define the gut flora in Indian population.Keywords:Indian population,Firmicutes/Bacteroidetesratio, Human gut microflora, YY-paradoxBackgroundThe gut micro flora plays an important role in healthstatus of the host as it contributes to overall metabolismand plays a role in converting food into nutrients andenergy [1]. Majority of microbes residing in the gut havea profound influence on human physiology and nutritionand are crucial for human life [2-4]. Gut microbiotashapes the host immune responses [5]. The compositionand activity of indigenous gut microbiota are of para-mount importance in the health of individual and hencedescribing the complexity of gut flora is important fordefining its effect on human health. The limited* Correspondence:drranade@gmail.com; yogesh@nccs.res.in1Microbial Culture Collection, National Centre for Cell Science, NCCSComplex, Ganeshkhind, Pune- 411 007, Maharashtra, India2Agharkar Research Institute, Gopal Ganesh Agarkar Road, Pune–411004,Maharashtra, Indiasensitivity of culture based method has been a problemin the past for defining the extent of microbial diversityin human gut. Recently, the molecular methods used forstudying the human gut flora have facilitated the accur-ate study of the human gut flora. Such studies showedthat the human gut microbiota varies greatly with factorssuch as age, genetic composition, gender, diseased andhealthy state of individual. [6-9]. Majority of the gutmicrobiota is composed of strict anaerobes, which dom-inate the facultative anaerobes and aerobes by two tothree orders of magnitude [10,11]. Although there havebeen over 50 bacterial phyla described, the human gutmicrobiota is dominated by only two of them:Bacteroi-detesandFirmicuteswhileProteobacteria, Verrucomicro-bia, Actinobacteria, Fusobacteria,andCyanobacteriaarepresent in minor proportions [12,13]. Studies have© 2012 Marathe et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creativereproduction in any medium, provided the original work is properly cited.Maratheet al. BMC Microbiology2012,12:222Page 2 of 10shown that the ratio ofFirmicutes/Bacteroideteschanges during challenged physiological conditions suchas obesity [14,15], although other studies did not observeany change [16,17]. Changes inFirmicutes/Bacteroidetesratio have also been reported in other physiological condi-tions such as ageing and diabetes [18,19].Different human ethnic groups vary in genetic makeupas well as the environmental conditions they live in. Thegut flora changes with genetic makeup and environmen-tal factors and hence, it is necessary to understand thecomposition of gut flora of different ethnic groups [20].However, little effort has been put into understandingthe composition of gut flora in Indian population. Thephysiology of Indian population is different from westernpopulation as suggested by YY- paradox and in turn thecomposition of gut microbes would be different [21].Hence, in this study we explored the change in compos-ition of gut microbiota in Indian individuals with differ-ent age within a family by using culture dependent andmolecular techniques. We selected two families eachwith three individuals belonging to successive genera-tions living under the same roof. Stool samples were col-lected and DNA extraction, DGGE analysis, preparationof 16S rRNA gene clone libraries was done and theresults were validated by qPCR. Obligate anaerobes wereisolated from samples collected from one family to studythe culturable diversity differences. Our results demon-strate the variation in gut microflora with age amongindividuals within a family; in addition the pattern ofchange inFirmicutes / Bacteroidetesratio with age isdifferent to what is previously reported in Europeanpopulation [16].Isolation of strict anaerobesMethodsSelection criteria for subjects and sample collectionSubjects from two healthy Indian joint-middle class fam-ilies with similar eating habits comprising of three suc-cessive generations staying under one roof and with nohistory of gastrointestinal diseases, no genetic disordersand no antibiotics consumed in the past six monthswere selected. Age of individuals in Family S was S1(26 years), S2 (8 months), and S3 (56 years) and in fam-ily T was T1 (14 years), T2 (42 years), and T3 (62 years).Stool samples were collected in a sterile N2 flushed bot-tles on the same day from each individual within a fam-ily and within 2 hours were transported to laboratory.Samples of family S were processed for isolation of strictanaerobes and remaining samples from both the familieswere frozen at−70°Cfor further molecular analysis. Allthe experiments were carried out with approval fromInstitutional (NCCS, Pune) Ethical Committee. Awritten informed consent was obtained from the sub-jects, in case of children written consent was obtainedfrom their parents.Three samples from family S were processed for isola-tion study. Each sample was serially diluted in pre-reduced sterile phosphate buffer (pH 7.0) 0.3 g, K2HPO4,0.18 g, KH2PO4, 0.45 g, NaCl, 0.46 g, (NH4) 2SO4,0.05 g, CaCl2, 0.09 g, Mg2SO4; H2O, 0.001 g, resazurin,0.5 g, L- cysteine HCl; H2O and observed under phasecontrast microscope (Nikon Eclipse 80i, Japan) in orderto obtain morphological details and density of bacteria(cells ml-1). Serial dilutions were carried and 0.1 ml ofeach dilution from 10-5to 10-8of the fresh sample wereplaced on the pre-reduced medium agar plates in an an-aerobic chamber (Anaerobic system 1029, Forma Scien-tific Inc., USA) with gas phase of N2:H2:CO2(85:10:5).The plates were incubated at 37°C in built-in incubatorin the anaerobic chamber. Two non-selective medianamely Peptone Yeast Extract Glucose (PYG), BrainHeart Infusion (BHI) (OXOID LTD., England) and oneselective medium namely Bile Esculin (BE) were used forthe isolation.Enrichments were set up for all fecal samples in PYG,BHI and BE medium to culture bacteria present in lownumbers in the feces. One gram of fecal sample was sus-pended in 9 ml pre-reduced sterile broth. After consecu-tive transfers to enrich different bacteria, the enrichmentcultures were serially diluted up to 10-8. The last fourdilutions were placed on the pre-reduced respectivemedium agar plates under anaerobic conditions andwere kept for incubation at 37°C.Direct isolation and enrichment plates were incubatedfor 5 days and well grown morphologically different col-onies were picked after every 24 h during the 5 days in-cubation. Transfer of selected colony into the liquidmedium was performed in the anaerobic chamber andthe purity of the isolates was confirmed by microscopyand re-isolation. The nature of growth (obligate/facultative)was confirmed by growing isolates in pre-reduced PYGmedium under both aerobic and anaerobic conditions. Outof 57 isolates obtained only 22 were confirmed as obligateanaerobes and were taken for further studies. Colonymorphologies were observed after 3 days of incubation.Cellular morphology was recorded after gram staining of48 hours old culture. Hanging drop preparation of 24 hourold culture broth was examined under phase contrastmicroscope for cellular motility [22].Extraction of genomic DNA from isolates and communityDNA extraction from stool samplesThe DNA was extracted from freshly grown culturesusing standard Phenol: Chloroform method [23]. Totalcommunity DNA was extracted from stool samplesusing QIAmp DNA Stool Mini kit (Qiagen, MadisonUSA) following manufacturer’s protocol.Maratheet al. BMC Microbiology2012,12:222Page 3 of 10Identification of isolates by 16S rRNA genesequence analysisThe isolates were identified by 16S rRNA gene sequencingusing universal primer set 27F (5'-CCAGAGTTT-GATCGTGGCTCAG-3') and 1488R (5'-CGGTTACCTT-GTTACGACTTCACC-3') [24]. All the PCR reactionswere carried out in a total volume of 25μl.The reactionconstituted 1X standard Taq Buffer, 200 nM dNTPs,0.4μMof each primers , 0.625 U Taq Polymerase (Ban-glore Genei, Banglore India) and 20 ng of template DNA.All PCR were performed for 35 cycles. Purified PCR pro-ducts were sequenced using BigDye Terminator Cycle Se-quencing Ready Reaction Kit v 3.1 in an automated3730xl DNA analyzer (Applied Biosystems Inc, USA).Biochemical characterization of the isolatesExtraction Kit (Sigma-aldrich, St Louis USA) and wereligated into pCR4WTOPO vector supplied with the TOPOTA cloning kit (Invitrogen, San Diego, USA) and trans-formed into One Shot TOPO10 electrocompetent cells ofE. coli(Invitrogen, San Diego, USA) following the manu-facturer’s instructions. Sterile LB agar with 50μg/mlofkanamycin were used for selection of the transformedcells which were incubated for 16 h at 37°C. M13F andM13R primers were used for screening and sequencing ofthe clones. The sequencing was done by ABI 3730 XLDNA analyser (Applied Biosystems Inc, USA) using theABI Big-Dye terminator version 3.1 sequencing kit as perthe manufacturer’s instructions.Phylogenetic analysisBiochemical characterization of the isolates was doneusing BIOLOG AN microplate following BIOLOGTMassay [25] and identified according to Bergey’s Manualfor Systematic Bacteriology. The pure cultures of anaer-obic bacteria grown on petri plates in anaerobic chamber(Forma Scientific, USA) were inoculated in Biolog anaer-obic inoculating fluid and the turbidity of the inoculumwas adjusted according to Biolog protocol. Hundredmicro liter of the inoculum was pipetted into each wellof 96 well AN microplates and incubated at 37°C in in-built incubator in anaerobic chamber. Incubation periodvaried from 48 to 72 hrs depending on the growth of thebacteria.DGGE analysis of the community DNAThe Denaturation Gradient Gel Electrophoresis (DGGE)PCR was done for the community DNA using the pri-mers 358F (40 GC 5’-CTACGGGAGGCAGCAG-3’) and517R (5’-CCGTCAATTC(A/C)TTTGAGTTT -3’) modi-fied linker primers [26]. The DGGE was performed in10% acrylamide: bis acrylamide (37.5:1) gel with a gradi-ent of 40% to 60%. One hundred percent of the denatur-ant corresponds to 7 M urea and 40% deionizedformamide. The electrophoresis was done using DCodeUniversal Mutation Detection System (BioRad, Hercules,CA, USA) at 80 V for 18 h at 60C. The gel was run in1 X TAE buffer (40 mM Tris, 20 mM Sodium acetate,1 mM EDTA) and stained with ethidium bromide. Thedocumentation of gel was done using Syngene G: boxgel documentation system (Syngene, Cambridge, UK).Clone library preparation from community DNASequences from each of the clone libraries were com-pared to the current database of 16S RNA genesequences at Ribosomal Database Project II [28]. Thesequences were assembled and contig’s were obtainedusing ChromasPro software, alignment was done usingCLUSTAL X2 and the sequences were edited manuallyusing DAMBE to get unambiguous sequence alignment.All sequences were checked for chimeric artifacts byMallard program, reference sequence used for this pur-pose wasE. coliU000096 [29] Appropriate subsets of16S rRNA gene sequences were selected on the basis ofinitial results and subjected to further phylogenetic ana-lysis using DNADIST of Phylip (version 3.61). The num-ber of Operational Taxonomic Units (OTU) (clonesequences with > 97% similarity grouped together as oneOTU) were obtained by DOTUR program (version 1.53)using furthest neighbor algorithm [30]. Representativesequences from each of the OTUs were retrieved andchecked against the previously determined 16S rRNAgene from the RDPII release 10 version of the databaseand these sequences were downloaded in FASTA format.Phylogenetic analyses were conducted usingMEGA,ver-sion 4 [31], and the phylogenetic trees were constructedusing neighbor-joining method with Kimura 2 parameter[32,33]. Normalized heat map was generated using MG-RAST, a modified version of RAST server, using RDPdatabase [34].Real time PCRTotal community DNA was used for preparing 16S rRNAgene libraries. The 16S rRNA gene was amplified withmodified universal primers for bacteria 8FI (5’GGATCCA-GACTTTGATYMTGGCTCAI-3’) and 907RI (5’- CCGT-CAATTCMTTTGAGTTI-3’) [27]. The PCR productwere purified by gel elution using Gene Elute GelThe Real Time PCR was done using the 7300 Real timePCR system from Applied Biosystems Inc. (USA) usingSYBR green master mix (Applied Biosystems Inc. USA).Primers used for absolute quantification were reportedearlier [19]. The primers used are listed in Table 1.Standards were prepared using these primers and thePCR products were gel eluted using Gene Elute Gel Ex-traction Kit (Sigma-aldrich, St Louis USA). The geleluted products were quantitated using nanodrop ND-1000spectrophotometer(JHBioinnovations,Maratheet al. BMC Microbiology2012,12:222Page 4 of 10Table 1 Primers used for Real-Time PCRTarget organismClostridium coccoides-Eubacteria rectalegroupPrevotellaLactobacillusgroupBacteroides-PrevotellagroupBifidobacteriumRoseburiaAll bacteriaPrimerClEubFClEubRPrevFPrevRLacFLacRBacFBacRBifFBifRRosFRosR27F343RSequenceCGGTACCTGACTAAGAAGCAGTTTYATTCTTGCGAACGCACCAAGGCGACGATCAGGATAACGCCYGGACCTAGCAGTAGGGAATCTTCCACACCGCTACACATGGAGGAAGGTCCCCCACATTGCAATCGGAGTTCTTCGTGGCGTGCTTAACACATGCAAGTCCACCCGTTTCCAGGAGCTATTTACTGCATTGGAAACTGTCGCGGCACCGAAGAGCAATTCCTACGGGAGGCAGCAGTGACTACCAGGGTATCTAATCCTGTTPCR product (bp)429 [47]283 [19]341 [48]410 [49]126 [50]230 [19]316 [This study]Legend: ClEub-Clostridium coccoides-Eubacteria rectalegroup specific primers,Prev- Prevotella genusspecific primers,Lac- Lactobacillus genusspecific primers,Bac-Prev- Bacteriodes-Prevotellaspecific primers,Bif- Bifidobacterium genusspecific primers, Ros- Roseburia genusspecific primers andAll bacteria-universal primers forall bacteria.Hyderabad India) and serial dilutions were made asstandards. Efficiency of PCR was calculated using theequation E = 10-1/slope–1 where, E is efficiency of PCR,mass of genome was calculated using the equationM = (n) - 1.096e-21 g/bp where M is mass of genomeand n is the PCR product size. The normalization wasdone by dividing the copy numbers of each bacterialgenus with total bacteria copy number. TheFirmicutes/Bacteroidetes ratio was calculated by dividing the nor-malized copy numbers ofLactobacillusgroup +Clostrid-ium coccoides-Eubacteria rectalegroup by the copynumber ofBacteroides-Prevotellagroup [18].Table 2 Identification of obligate anaerobic isolates by 16 S rRNA gene sequence analysisSampleS2(8 months)IsolateSLPYG 1SLPYG 2SLPYG 3SLBE 4SLBE 5S1(26 years)VLPYG 2VLPYG 3VLPYG 4VLPYG 5VLPYG 6VLBE 7VLBE 8VLBE 9S3(56 years)BLBE 1BLBE 2BLPYG 5BLBE 6BLPYG 7BLPYG 8BLPYG 9BLBE 11BLBE 12Closest BLAST hitBifidobacteria adolescentisParabacteroides distasonisParabacteroides distasonisParabacteroides distasonisParabacteroides distasonisClostridium subterminaleBacteroides vulgatesParabacteroides distasonisClostridium difficileClostridium mangenotiiBacteroides fragilisBacteroides thetaiotaomicronBacteroides thetaiotaomicronParabacteroides distasonisBacteroides ovatusBacteroides uniformisBacteroides xylanisolvensMegasphaera elsdeniiClostridium subterminaleBacteroides fragilisParabacteroides distasonisParabacteroides distasonisPercent similarity97%99%99%99%99%99%99%99%96%98%99%99%99%97%98%99%99%97%96%97%99%99%Gene bank accession numbersJN389522JN038555JN038556JN038557JN038558JN093125JN084207JN038554JN093126JN093127JN084198JN084201JN084202JN038559JN084211JN084205JN084212HM990964JN093128JN084199JN038560JN038561Maratheet al. BMC Microbiology2012,12:222Page 5 of 10ResultsBiochemical and molecular characteristics of the humanfecal isolatesTotal 22 strict anaerobic bacteria isolates were obtainedfrom human fecal samples from three healthy volun-teers. These bacterial isolates were identified using 16SrRNA gene sequence analysis. Different bacterial specieswere isolated from different aged individuals with infantshowing the least diversity (only two species were iso-lated) with 4 isolates beingParabacteroides distasonisand 1 isolate beingBifidobacterium adolscentis.The iso-lates from samples S1 and S3 belonged to genusBacter-iodes, Clostridium, Parabacteroides;whileMegasphaeraelsdeniiwas isolated from S3 only (age56).This suggeststhat there is difference in culturable anaerobic bacteriadiversity with age within individuals in a family.None of the isolate showed 100% sequence similaritywith the known sequences in database, with 27% (6 outof 22) of the isolates showing 97% or less similarity tothe type strains suggesting that they are novel species.These potential novel isolates were closely related to 6different bacterial species belonging to 5 different genera(Table 2), suggesting a high diversity of novel bacterialspecies. The isolation of novel species also showed agerelated difference among the individuals, novel speciesclosely related toBifidobacteria adolescentiswas isolatedonly from infant while novel species closely related toClostridium difficilewas isolated only from S1 (adult).The sample S3 showed high diversity of novel isolateswith presence of 4 novel isolates closely related toPara-bacteroides distasonis, Megasphaera elsdenii, Clostrid-ium subterminale, Bacteroides fragilisrespectively. Thissuggests that there is difference in culturable anaerobicbacteria diversity with age within individuals in a family.Biochemical characteristics of the isolates were analyzedusing BIOLOGTM. The isolates were grouped in 5 differ-ent phenotypes based on obtained characteristics. Theidentifications and accession numbers of the 16SrRNAgene sequence of the isolates are represented in Table 2.DGGE analysisFigure 1DGGE analysis of the stool DNA, denaturationgradient 40%-60%.Family S: S1 (26 years), S2 (8 months),S3 (56 years) and Family T: T1 (14 years), T2 (42 years),T3 (62 years). Legend : Lane 1- S2, lane 2- S1, lane 3- S3,lane 4- T1, lane 5- T2, lane 6- T3.The DGGE analysis revealed the difference in gut floracomposition of individuals of different age belonging tothe same family as shown in Figure 1. The band intensityand number of bands observed in DGGE profile of sam-ples suggests that different bacterial species are dominat-ing the gut flora of individuals of varying age.Clone library analysisTotal 960 clone sequences from the 6 clone librarieswere obtained and analyzed. The sequences are submit-ted to NCBI with accession numbers from JQ264784 toJQ265743. On the basis of sequence similarities asobtained from Ribosomal Database Project II (RDP II),the sequences were grouped into PhylumFirmicutes,Bacteroidetes, Proteobacteria, Actinobacteria, Verrucomi-crobia.The clone library analysis showed consistent de-crease in theFirmicutesand consistent increase inBacteroidetesin both the families with an increase in age(Figure 2). The family level variation in microflora inindividuals is shown in Additional file 1: Table S1. Thegenera which were dominant in the individual samplesare represented in Figure 3. The heat map representedin Figure 3 shows that the individuals within a samefamily cluster together when genus level distribution ofgut flora is considered. Within family T,FecalibacteriumandRoseburiadominated in subject T1 (age 14)Dialis-ter, Prevotelladominated in subject T2 (age 42) andPre-votellain subject T3 (age 62). Within family S the genus [ Pobierz całość w formacie PDF ]

Changes in human gut flora with age, ARTYKUŁY NAUKOWE (probiotyki, mikroflora, germ-free)

Odnośniki